pgl2-basic vector (Promega)
90
Structured Review
Promega
pgl2-basic vector
Pgl2 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2+basic+vector/pgl3+basic/pmc11080286-89-36-38
Average 90 stars, based on 1 article reviews
Pgl2 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl2+basic+vector/pgl3+basic/pmc11080286-89-36-38
Average 90 stars, based on 1 article reviews
pgl2-basic vector - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Luciferase:Article Title: Estrogen-related receptor alpha promotes thyroid tumor cell survival via a tumor subtype-specific regulation of target gene networks Article Snippet: Luciferase reporter assays Page 14/34 A DNA fragment spanning from − 1259 base pair to + 22 base pair of HSPA9 promoter was PCR ampli ed from the genomic DNA of TPC1 cells, using AccuPrimeTM Pfx SuperMix (Invitrogen, #12344040) and the primers GTAGTTGACATCCTGCCACC and CAGCTCGGCTGGCACTTATC, and cloned into TOPO-TA vector (Invitrogen, #K466040). .. To generate the luciferase reporter p1259, the HSPA9 promoter in this TOPO vector was ampli ed using TTCGCCCTGGTACCTGACATCCT and GCCCTTCAGATCTGCTGGCACTT and was ligated into the KpnI/BgIII sites of Article Title: The endogenous retrovirus ENS-1 provides active binding sites for transcription factors in embryonic stem cells that specify extra embryonic tissue Article Snippet: Whole IgG purified from mice were from Zymed. .. The luciferase reporter construct p455-Luc was done using the Article Title: Interdependence of hypoxia and β-adrenergic receptor signaling in pulmonary arterial hypertension Article Snippet: .. The luciferase reporter vector was a Article Title: Asxl1 deficiency in embryonic fibroblasts leads to cellular senescence via impairment of the AKT-E2F pathway and Ezh2 inactivation Article Snippet: For GST-fused and His-tagged proteins, the pGEX4T-1 (GE Healthcare, Piscataway, NJ) and pET15b (Novagen, Madison, WI) vectors were used. .. The p16Ink4a promoter-driven luciferase reporter was created by inserting the p16Ink4a promoter (3,000 bp), amplified by PCR using genomic DNA of mouse tails, into the Plasmid Preparation:Article Title: Estrogen-related receptor alpha promotes thyroid tumor cell survival via a tumor subtype-specific regulation of target gene networks Article Snippet: Luciferase reporter assays Page 14/34 A DNA fragment spanning from − 1259 base pair to + 22 base pair of HSPA9 promoter was PCR ampli ed from the genomic DNA of TPC1 cells, using AccuPrimeTM Pfx SuperMix (Invitrogen, #12344040) and the primers GTAGTTGACATCCTGCCACC and CAGCTCGGCTGGCACTTATC, and cloned into TOPO-TA vector (Invitrogen, #K466040). .. To generate the luciferase reporter p1259, the HSPA9 promoter in this TOPO vector was ampli ed using TTCGCCCTGGTACCTGACATCCT and GCCCTTCAGATCTGCTGGCACTT and was ligated into the KpnI/BgIII sites of Article Title: Estradiol Induced Estrogen Receptor-mediated Transcription and Expression of Aquaporin5 Article Snippet: In this study, we constructed the recombinant plasmid of pGL2/Aquaporin5(AQP5) promoter (pGL2/AQP5p) luciferase reporter, then found estradiol(E2) induced AQP5 promoter activation in a dose-dependent manner.. Further, we identified endogenous estrogen receptors(ER), including ERα and ERβ, expressed in human submandibular gland(HSG) cells, which responded to E2.. Then demonstrated by the stimulation of E2, AQP5 was upregulated in protein level, meanwhile AQP5 located in cytomembrane was elevated in immunofluorescence. Article Title: Interdependence of hypoxia and β-adrenergic receptor signaling in pulmonary arterial hypertension Article Snippet: .. The luciferase reporter vector was a Article Title: Involvement of c-Fos in the Promotion of Cancer Stem-like Cell Properties in Head and Neck Squamous Cell Carcinoma Article Snippet: Photographs were captured at 0 and 24 h from more than three randomly selected fields using inverted microscope (Leica). .. MDA1386Tu control and MDA1386Tu-c-Fos cells were transfected with Article Title: Asxl1 deficiency in embryonic fibroblasts leads to cellular senescence via impairment of the AKT-E2F pathway and Ezh2 inactivation Article Snippet: For GST-fused and His-tagged proteins, the pGEX4T-1 (GE Healthcare, Piscataway, NJ) and pET15b (Novagen, Madison, WI) vectors were used. .. The p16Ink4a promoter-driven luciferase reporter was created by inserting the p16Ink4a promoter (3,000 bp), amplified by PCR using genomic DNA of mouse tails, into the Article Title: Brg1 Directly Regulates Olig2 Transcription and is Required for Oligodendrocyte Progenitor Cell Specification Article Snippet: .. After purification, the fragment was ligated to blunted MluI and XhoI sites of the Article Title: RaRF confers RA resistance by sequestering RAR to the nucleolus and regulating MCL1 in leukemia cells. Article Snippet: Retinoic acid (RA) has broad clinical applications for the treatment of various cancers, particularly acute promyelocytic leukemia.. However, RA-based therapy is limited by relapse in patients associated with RA resistance, the mechanism of which is poorly understood.. Here, we suggest a new molecular mechanism of RA resistance by a repressor, named RA resistance factor (RaRF). Construct:Article Title: The endogenous retrovirus ENS-1 provides active binding sites for transcription factors in embryonic stem cells that specify extra embryonic tissue Article Snippet: Whole IgG purified from mice were from Zymed. .. The luciferase reporter construct p455-Luc was done using the Sequencing:Article Title: The endogenous retrovirus ENS-1 provides active binding sites for transcription factors in embryonic stem cells that specify extra embryonic tissue Article Snippet: Whole IgG purified from mice were from Zymed. .. The luciferase reporter construct p455-Luc was done using the Article Title: Interdependence of hypoxia and β-adrenergic receptor signaling in pulmonary arterial hypertension Article Snippet: .. The luciferase reporter vector was a Article Title: Involvement of c-Fos in the Promotion of Cancer Stem-like Cell Properties in Head and Neck Squamous Cell Carcinoma Article Snippet: Photographs were captured at 0 and 24 h from more than three randomly selected fields using inverted microscope (Leica). .. MDA1386Tu control and MDA1386Tu-c-Fos cells were transfected with Article Title: RaRF confers RA resistance by sequestering RAR to the nucleolus and regulating MCL1 in leukemia cells. Article Snippet: Retinoic acid (RA) has broad clinical applications for the treatment of various cancers, particularly acute promyelocytic leukemia.. However, RA-based therapy is limited by relapse in patients associated with RA resistance, the mechanism of which is poorly understood.. Here, we suggest a new molecular mechanism of RA resistance by a repressor, named RA resistance factor (RaRF). Control:Article Title: Involvement of c-Fos in the Promotion of Cancer Stem-like Cell Properties in Head and Neck Squamous Cell Carcinoma Article Snippet: Photographs were captured at 0 and 24 h from more than three randomly selected fields using inverted microscope (Leica). .. MDA1386Tu control and MDA1386Tu-c-Fos cells were transfected with Transfection:Article Title: Involvement of c-Fos in the Promotion of Cancer Stem-like Cell Properties in Head and Neck Squamous Cell Carcinoma Article Snippet: Photographs were captured at 0 and 24 h from more than three randomly selected fields using inverted microscope (Leica). .. MDA1386Tu control and MDA1386Tu-c-Fos cells were transfected with Amplification:Article Title: Asxl1 deficiency in embryonic fibroblasts leads to cellular senescence via impairment of the AKT-E2F pathway and Ezh2 inactivation Article Snippet: For GST-fused and His-tagged proteins, the pGEX4T-1 (GE Healthcare, Piscataway, NJ) and pET15b (Novagen, Madison, WI) vectors were used. .. The p16Ink4a promoter-driven luciferase reporter was created by inserting the p16Ink4a promoter (3,000 bp), amplified by PCR using genomic DNA of mouse tails, into the Article Title: RaRF confers RA resistance by sequestering RAR to the nucleolus and regulating MCL1 in leukemia cells. Article Snippet: Retinoic acid (RA) has broad clinical applications for the treatment of various cancers, particularly acute promyelocytic leukemia.. However, RA-based therapy is limited by relapse in patients associated with RA resistance, the mechanism of which is poorly understood.. Here, we suggest a new molecular mechanism of RA resistance by a repressor, named RA resistance factor (RaRF). Polymerase Chain Reaction:Article Title: Asxl1 deficiency in embryonic fibroblasts leads to cellular senescence via impairment of the AKT-E2F pathway and Ezh2 inactivation Article Snippet: For GST-fused and His-tagged proteins, the pGEX4T-1 (GE Healthcare, Piscataway, NJ) and pET15b (Novagen, Madison, WI) vectors were used. .. The p16Ink4a promoter-driven luciferase reporter was created by inserting the p16Ink4a promoter (3,000 bp), amplified by PCR using genomic DNA of mouse tails, into the Article Title: RaRF confers RA resistance by sequestering RAR to the nucleolus and regulating MCL1 in leukemia cells. Article Snippet: Retinoic acid (RA) has broad clinical applications for the treatment of various cancers, particularly acute promyelocytic leukemia.. However, RA-based therapy is limited by relapse in patients associated with RA resistance, the mechanism of which is poorly understood.. Here, we suggest a new molecular mechanism of RA resistance by a repressor, named RA resistance factor (RaRF). Purification:Article Title: Brg1 Directly Regulates Olig2 Transcription and is Required for Oligodendrocyte Progenitor Cell Specification Article Snippet: .. After purification, the fragment was ligated to blunted MluI and XhoI sites of the Promoter Assay:Article Title: RaRF confers RA resistance by sequestering RAR to the nucleolus and regulating MCL1 in leukemia cells. Article Snippet: Retinoic acid (RA) has broad clinical applications for the treatment of various cancers, particularly acute promyelocytic leukemia.. However, RA-based therapy is limited by relapse in patients associated with RA resistance, the mechanism of which is poorly understood.. Here, we suggest a new molecular mechanism of RA resistance by a repressor, named RA resistance factor (RaRF). |